Abstract
A RAPID PCR ASSAY FOR IDENTIFICATION OF MALES IN WIDOW TETRA, GYMNOCORYMBUS TERNETZI (BOULENGER, 1895)

Clifton Justin David* and T. J. Pandian

ABSTRACT

Non-invasive, early sex determination using molecular markers have potential application in aquaculture and human genetics. Double Sex/Male abnormal Protein (mab3) related transcription factors (Dmrt) family genes may be useful as Y chromosome-specific markers for determining maleness in fishes and humans. Objectives: To develop a rapid PCR assay for early identification of androgenetic clones (Y2Y2) and unexpected females (X1Y2) with male genotype in widow tetra (WT), Gymnocorymbus ternetzi larvae using Dmrt1, a male-specific marker. Methods: Genomic DNA isolated from larval tail fins of 8 androgenetic males (Y2Y2) and 4 unexpected female progenies (X1Y2), produced by progeny testing of androgenetic males were selected. A robust PCR protocol was optimized using primers for Dmrt1 specific genes (Dmrt1F –AAGTGCTCCCGCTGCCGGAA; Dmrt1R -GCTGGTACTGCTGGTAGTTG). The amplified genomic products were identified using agarose gel (2.5%) electrophoresis, cloned and sequenced. Results: Dmrt1 specific primer amplified a Y chromosome-specific 300 bp and 237 bp amplicons in WT males which was absent in females. Sequencing of the 237 bp amplicon confirmed homology (84%) with previously reported medaka and Buenos Aires tetra (BA tetra) Dmrt sequences. Conclusion: Y chromosome-specific markers have profound applications in human foetal sex determination and early identification of males in genetically manipulated fishes.

Keywords: Dmrt1, Y chromosome-specific markers, PCR assay, genomic DNA, androgenetic clones, Human.


[Full Text Article]   [Download Certificate]

Login





Forgot Password  |  Register

Indexing

Best Paper Awards

European Journal of Biomedical and Pharmaceutical Sciences (EJBPS) will give best paper award in every issue in the form of money along with certificate to promote research activity of scholar.

Best Article of current issue :

Dr. Dhrubo Jyoti Sen

Download Article : Click here

News & Updation

  • EJBPS New Impact Factor

    EJBPS Impact Factor has been Increased to 7.482 for Year 2024.

  • EJBPS: FEBRUARY ISSUE PUBLISHED

    FEBRUARY 2024 Issue has been successfully launched on 1 FEBRUARY 2024.

  • Index Copernicus Value

    EJBPS Received Index Copernicus Value 77.3, due to High Quality Publication in EJBPS at International Level

  • Journal web site support Internet Explorer, Google Chrome, Mozilla Firefox, Opera, Saffari for easy download of article without any trouble.

    .

  • Article Invited for Publication

    Dear Researcher, Article Invited for Publication  in EJBPS coming Issue.

     

UG/PG/Ph.D Research Publication

Research Scholar of UG/PG/Ph.D can Submit their Research Article/Review Article/Case Study/Short Communication for Publication in EJBPS

Downloads

Copyright From

Covering Letter

                        Author Instruction 
 

PLAGERLUM REPORT